e.g. 1:1246..9423
SNP Detail For snp_cf0060000000010    [See in GBrowse]
1.General Information
SNP ID: snp_cf0060000000010
Organism: Canis familiaris
Individual: TM1
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: ACCAGAGGTCATTTGCAATTGCTCTCTTAG
3'flank: AGCTCCAGGGAAGGGGGAAGGAGCTAGATA
3.Reference Map information
Chrom Position Reference TM1
Chr1 34323 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0038000000014 KM3 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0071000000009 YJ2 A ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0032000000011 GS8 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0045000000009 LJ10 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0061000000011 TM2 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0023000000017 FAMICHN00003 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0035000000010 KM10 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0068000000009 TM9 A ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0041000000011 KM6 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0009000000013 DQ1 A ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0054000000009 LJ9 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0004000000008 Basenji R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0070000000012 YJ1 A ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0073000000012 YJ4 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0013000000007 DQ5 A ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0049000000014 LJ4 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0014000000012 DQ6 A ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0078000000010 YJ9 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0040000000014 KM5 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0043000000013 KM8 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0012000000008 DQ4 A ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0052000000010 LJ7 A ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0053000000009 LJ8 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0059000000008 TM10 A ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0044000000007 KM9 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0046000000014 LJ1 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0037000000013 KM2 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0039000000012 KM4 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0062000000006 TM3 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0063000000012 TM4 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0019000000013 FAMBGSD00001 A ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0025000000012 GS1 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0066000000012 TM7 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0022000000011 FAMICHN00002 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0064000000005 TM5 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0042000000014 KM7 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0016000000015 DQ8 A ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0069000000010 YJ10 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0036000000015 KM1 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0074000000011 YJ5 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0010000000011 DQ2 A ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0067000000008 TM8 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0017000000011 DQ9 A ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0027000000014 GS3 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0015000000014 DQ7 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
snp_cf0020000000009 FAMBTIM00001 R ACCAGAGGTCATTTGCAATTGCTCTCTTAG AGCTCCAGGGAAGGGGGAAGGAGCTAGATA 2014-07-19 2014-07-19
6.Fasta Information
GTCCCCCAAC ACAGGCTGCC ACCAGAGGTC ATTTGCAATT GCTCTCTTAG
R
AGCTCCAGGG AAGGGGGAAG GAGCTAGATA GGAAGACGGG ATGCGTGGAG