e.g. 1:1246..9423
SNP Detail For snp_cf0069000000007    [See in GBrowse]
1.General Information
SNP ID: snp_cf0069000000007
Organism: Canis familiaris
Individual: YJ10
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: M
5'flank: CCTAGTAATTCCTGTGGTAGACTGGTGCTA
3'flank: ATACTAAGTTCAATATACGTGAGAAGGTAG
3.Reference Map information
Chrom Position Reference YJ10
Chr1 30784 C M
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0074000000007 YJ5 M CCTAGTAATTCCTGTGGTAGACTGGTGCTA ATACTAAGTTCAATATACGTGAGAAGGTAG 2014-07-19 2014-07-19
snp_cf0067000000004 TM8 M CCTAGTAATTCCTGTGGTAGACTGGTGCTA ATACTAAGTTCAATATACGTGAGAAGGTAG 2014-07-19 2014-07-19
6.Fasta Information
CAAGCTCAAT CCAGCGATTT CCTAGTAATT CCTGTGGTAG ACTGGTGCTA
M
ATACTAAGTT CAATATACGT GAGAAGGTAG CTAACGCCTT GTCCAAAAAC