e.g. 1:1246..9423
SNP Detail For snp_cf0073000000007    [See in GBrowse]
1.General Information
SNP ID: snp_cf0073000000007
Organism: Canis familiaris
Individual: YJ4
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: S
5'flank: AGGCATGCTTCCCTGTGAGAACTGAGGACA
3'flank: CGCAGTACCCTCCTGCATGCTGCCTGACTG
3.Reference Map information
Chrom Position Reference YJ4
Chr1 30370 G S
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0051000000011 LJ6 C AGGCATGCTTCCCTGTGAGAACTGAGGACA CGCAGTACCCTCCTGCATGCTGCCTGACTG 2014-07-19 2014-07-19
snp_cf0061000000006 TM2 S AGGCATGCTTCCCTGTGAGAACTGAGGACA CGCAGTACCCTCCTGCATGCTGCCTGACTG 2014-07-19 2014-07-19
snp_cf0038000000009 KM3 S AGGCATGCTTCCCTGTGAGAACTGAGGACA CGCAGTACCCTCCTGCATGCTGCCTGACTG 2014-07-19 2014-07-19
snp_cf0049000000009 LJ4 S AGGCATGCTTCCCTGTGAGAACTGAGGACA CGCAGTACCCTCCTGCATGCTGCCTGACTG 2014-07-19 2014-07-19
snp_cf0077000000011 YJ8 S AGGCATGCTTCCCTGTGAGAACTGAGGACA CGCAGTACCCTCCTGCATGCTGCCTGACTG 2014-07-19 2014-07-19
snp_cf0076000000007 YJ7 S AGGCATGCTTCCCTGTGAGAACTGAGGACA CGCAGTACCCTCCTGCATGCTGCCTGACTG 2014-07-19 2014-07-19
snp_cf0054000000005 LJ9 S AGGCATGCTTCCCTGTGAGAACTGAGGACA CGCAGTACCCTCCTGCATGCTGCCTGACTG 2014-07-19 2014-07-19
snp_cf0048000000009 LJ3 S AGGCATGCTTCCCTGTGAGAACTGAGGACA CGCAGTACCCTCCTGCATGCTGCCTGACTG 2014-07-19 2014-07-19
snp_cf0075000000012 YJ6 C AGGCATGCTTCCCTGTGAGAACTGAGGACA CGCAGTACCCTCCTGCATGCTGCCTGACTG 2014-07-19 2014-07-19
snp_cf0037000000008 KM2 S AGGCATGCTTCCCTGTGAGAACTGAGGACA CGCAGTACCCTCCTGCATGCTGCCTGACTG 2014-07-19 2014-07-19
snp_cf0063000000007 TM4 S AGGCATGCTTCCCTGTGAGAACTGAGGACA CGCAGTACCCTCCTGCATGCTGCCTGACTG 2014-07-19 2014-07-19
snp_cf0036000000010 KM1 S AGGCATGCTTCCCTGTGAGAACTGAGGACA CGCAGTACCCTCCTGCATGCTGCCTGACTG 2014-07-19 2014-07-19
snp_cf0008000000005 DQ10 C AGGCATGCTTCCCTGTGAGAACTGAGGACA CGCAGTACCCTCCTGCATGCTGCCTGACTG 2014-07-19 2014-07-19
snp_cf0070000000009 YJ1 S AGGCATGCTTCCCTGTGAGAACTGAGGACA CGCAGTACCCTCCTGCATGCTGCCTGACTG 2014-07-19 2014-07-19
snp_cf0021000000009 FAMICHN00001 S AGGCATGCTTCCCTGTGAGAACTGAGGACA CGCAGTACCCTCCTGCATGCTGCCTGACTG 2014-07-19 2014-07-19
snp_cf0011000000010 DQ3 S AGGCATGCTTCCCTGTGAGAACTGAGGACA CGCAGTACCCTCCTGCATGCTGCCTGACTG 2014-07-19 2014-07-19
snp_cf0050000000012 LJ5 S AGGCATGCTTCCCTGTGAGAACTGAGGACA CGCAGTACCCTCCTGCATGCTGCCTGACTG 2014-07-19 2014-07-19
snp_cf0072000000005 YJ3 S AGGCATGCTTCCCTGTGAGAACTGAGGACA CGCAGTACCCTCCTGCATGCTGCCTGACTG 2014-07-19 2014-07-19
snp_cf0066000000009 TM7 C AGGCATGCTTCCCTGTGAGAACTGAGGACA CGCAGTACCCTCCTGCATGCTGCCTGACTG 2014-07-19 2014-07-19
snp_cf0046000000009 LJ1 S AGGCATGCTTCCCTGTGAGAACTGAGGACA CGCAGTACCCTCCTGCATGCTGCCTGACTG 2014-07-19 2014-07-19
snp_cf0034000000014 ISW S AGGCATGCTTCCCTGTGAGAACTGAGGACA CGCAGTACCCTCCTGCATGCTGCCTGACTG 2014-07-19 2014-07-19
6.Fasta Information
CTAGGTGAGA GCTGGCTTCT AGGCATGCTT CCCTGTGAGA ACTGAGGACA
S
CGCAGTACCC TCCTGCATGC TGCCTGACTG TAGACGTAGC TGCTAACATC