e.g. 1:1246..9423
SNP Detail For snp_cf0073000000009    [See in GBrowse]
1.General Information
SNP ID: snp_cf0073000000009
Organism: Canis familiaris
Individual: YJ4
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: TGCCTCAGAATGAGTTTCGAACATGTTGAC
3'flank: AGAGACGTTTTTCAGAAACTGGAGAGACGC
3.Reference Map information
Chrom Position Reference YJ4
Chr1 33327 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0048000000013 LJ3 Y TGCCTCAGAATGAGTTTCGAACATGTTGAC AGAGACGTTTTTCAGAAACTGGAGAGACGC 2014-07-19 2014-07-19
snp_cf0076000000012 YJ7 Y TGCCTCAGAATGAGTTTCGAACATGTTGAC AGAGACGTTTTTCAGAAACTGGAGAGACGC 2014-07-19 2014-07-19
snp_cf0037000000011 KM2 Y TGCCTCAGAATGAGTTTCGAACATGTTGAC AGAGACGTTTTTCAGAAACTGGAGAGACGC 2014-07-19 2014-07-19
snp_cf0023000000015 FAMICHN00003 Y TGCCTCAGAATGAGTTTCGAACATGTTGAC AGAGACGTTTTTCAGAAACTGGAGAGACGC 2014-07-19 2014-07-19
snp_cf0072000000009 YJ3 Y TGCCTCAGAATGAGTTTCGAACATGTTGAC AGAGACGTTTTTCAGAAACTGGAGAGACGC 2014-07-19 2014-07-19
snp_cf0051000000013 LJ6 T TGCCTCAGAATGAGTTTCGAACATGTTGAC AGAGACGTTTTTCAGAAACTGGAGAGACGC 2014-07-19 2014-07-19
snp_cf0054000000007 LJ9 Y TGCCTCAGAATGAGTTTCGAACATGTTGAC AGAGACGTTTTTCAGAAACTGGAGAGACGC 2014-07-19 2014-07-19
snp_cf0036000000013 KM1 Y TGCCTCAGAATGAGTTTCGAACATGTTGAC AGAGACGTTTTTCAGAAACTGGAGAGACGC 2014-07-19 2014-07-19
snp_cf0077000000014 YJ8 Y TGCCTCAGAATGAGTTTCGAACATGTTGAC AGAGACGTTTTTCAGAAACTGGAGAGACGC 2014-07-19 2014-07-19
snp_cf0046000000012 LJ1 Y TGCCTCAGAATGAGTTTCGAACATGTTGAC AGAGACGTTTTTCAGAAACTGGAGAGACGC 2014-07-19 2014-07-19
snp_cf0008000000007 DQ10 T TGCCTCAGAATGAGTTTCGAACATGTTGAC AGAGACGTTTTTCAGAAACTGGAGAGACGC 2014-07-19 2014-07-19
snp_cf0050000000018 LJ5 Y TGCCTCAGAATGAGTTTCGAACATGTTGAC AGAGACGTTTTTCAGAAACTGGAGAGACGC 2014-07-19 2014-07-19
snp_cf0049000000012 LJ4 Y TGCCTCAGAATGAGTTTCGAACATGTTGAC AGAGACGTTTTTCAGAAACTGGAGAGACGC 2014-07-19 2014-07-19
snp_cf0011000000014 DQ3 Y TGCCTCAGAATGAGTTTCGAACATGTTGAC AGAGACGTTTTTCAGAAACTGGAGAGACGC 2014-07-19 2014-07-19
snp_cf0034000000018 ISW Y TGCCTCAGAATGAGTTTCGAACATGTTGAC AGAGACGTTTTTCAGAAACTGGAGAGACGC 2014-07-19 2014-07-19
snp_cf0066000000011 TM7 Y TGCCTCAGAATGAGTTTCGAACATGTTGAC AGAGACGTTTTTCAGAAACTGGAGAGACGC 2014-07-19 2014-07-19
snp_cf0063000000010 TM4 Y TGCCTCAGAATGAGTTTCGAACATGTTGAC AGAGACGTTTTTCAGAAACTGGAGAGACGC 2014-07-19 2014-07-19
snp_cf0061000000009 TM2 Y TGCCTCAGAATGAGTTTCGAACATGTTGAC AGAGACGTTTTTCAGAAACTGGAGAGACGC 2014-07-19 2014-07-19
snp_cf0075000000014 YJ6 T TGCCTCAGAATGAGTTTCGAACATGTTGAC AGAGACGTTTTTCAGAAACTGGAGAGACGC 2014-07-19 2014-07-19
snp_cf0021000000013 FAMICHN00001 Y TGCCTCAGAATGAGTTTCGAACATGTTGAC AGAGACGTTTTTCAGAAACTGGAGAGACGC 2014-07-19 2014-07-19
snp_cf0038000000012 KM3 Y TGCCTCAGAATGAGTTTCGAACATGTTGAC AGAGACGTTTTTCAGAAACTGGAGAGACGC 2014-07-19 2014-07-19
6.Fasta Information
CCCAGTCCCA CCGTTCCAAC TGCCTCAGAA TGAGTTTCGA ACATGTTGAC
Y
AGAGACGTTT TTCAGAAACT GGAGAGACGC AAGTGGAATA ATGGAGGCAT