e.g. 1:1246..9423
SNP Detail For snp_cf0074000000006    [See in GBrowse]
1.General Information
SNP ID: snp_cf0074000000006
Organism: Canis familiaris
Individual: YJ5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: K
5'flank: CTCAGACGGTATCTCCAGGTGCAGTAGAGT
3'flank: GTAATCTTGGAACCTACTGACTCAGAATAC
3.Reference Map information
Chrom Position Reference YJ5
Chr1 30259 T K
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0019000000006 FAMBGSD00001 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0013000000004 DQ5 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0010000000008 DQ2 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0004000000005 Basenji G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0068000000006 TM9 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0022000000006 FAMICHN00002 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0007000000006 Dingo G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0053000000005 LJ8 K CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0075000000011 YJ6 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0059000000005 TM10 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0044000000004 KM9 K CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0065000000006 TM6 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0016000000012 DQ8 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0071000000006 YJ2 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0062000000003 TM3 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0056000000007 LUPWRUS00001 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0029000000004 GS5 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0023000000009 FAMICHN00003 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0041000000005 KM6 K CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0076000000006 YJ7 K CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0077000000010 YJ8 K CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0035000000007 KM10 K CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0017000000006 DQ9 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0064000000002 TM5 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0069000000006 YJ10 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0063000000006 TM4 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0070000000008 YJ1 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0040000000008 KM5 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0011000000009 DQ3 K CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0046000000008 LJ1 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0028000000003 GS4 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0052000000007 LJ7 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0045000000006 LJ10 K CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0042000000008 KM7 K CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0048000000008 LJ3 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0009000000010 DQ1 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0036000000009 KM1 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0057000000008 LUPWRUS00002 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0058000000011 LUPWRUS00003 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0054000000004 LJ9 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0039000000008 KM4 K CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0008000000004 DQ10 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0024000000006 GS10 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0015000000009 DQ7 K CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0060000000007 TM1 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0027000000008 GS3 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0021000000008 FAMICHN00001 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0018000000006 FAMBBEM00001 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0033000000003 GS9 K CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0012000000005 DQ4 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0034000000012 ISW G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0006000000008 CRW K CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0030000000003 GS6 K CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0067000000003 TM8 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0051000000010 LJ6 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0061000000005 TM2 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0038000000008 KM3 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0055000000007 LUPWCHN00001 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0049000000008 LJ4 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0073000000006 YJ4 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0026000000005 GS2 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0032000000005 GS8 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0066000000008 TM7 K CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0037000000007 KM2 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0031000000007 GS7 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0050000000011 LJ5 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0072000000004 YJ3 K CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0014000000009 DQ6 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0025000000006 GS1 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0078000000007 YJ9 K CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0020000000006 FAMBTIM00001 K CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
snp_cf0043000000007 KM8 G CTCAGACGGTATCTCCAGGTGCAGTAGAGT GTAATCTTGGAACCTACTGACTCAGAATAC 2014-07-19 2014-07-19
6.Fasta Information
AGGCAACTTA ACAATGCAGA CTCAGACGGT ATCTCCAGGT GCAGTAGAGT
K
GTAATCTTGG AACCTACTGA CTCAGAATAC TGCTACCTTC TCACTGCCAT