e.g. 1:1246..9423
SNP Detail For snp_cf0074000000009    [See in GBrowse]
1.General Information
SNP ID: snp_cf0074000000009
Organism: Canis familiaris
Individual: YJ5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: CCTAGAATCCTTATGTTAGGTGTTGGTAGA
3'flank: GATGTGTGAAAAGCATGTGGAAGTGACAGG
3.Reference Map information
Chrom Position Reference YJ5
Chr1 33588 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0073000000010 YJ4 R CCTAGAATCCTTATGTTAGGTGTTGGTAGA GATGTGTGAAAAGCATGTGGAAGTGACAGG 2014-07-19 2014-07-19
snp_cf0054000000008 LJ9 R CCTAGAATCCTTATGTTAGGTGTTGGTAGA GATGTGTGAAAAGCATGTGGAAGTGACAGG 2014-07-19 2014-07-19
snp_cf0015000000012 DQ7 R CCTAGAATCCTTATGTTAGGTGTTGGTAGA GATGTGTGAAAAGCATGTGGAAGTGACAGG 2014-07-19 2014-07-19
snp_cf0067000000006 TM8 R CCTAGAATCCTTATGTTAGGTGTTGGTAGA GATGTGTGAAAAGCATGTGGAAGTGACAGG 2014-07-19 2014-07-19
snp_cf0014000000010 DQ6 R CCTAGAATCCTTATGTTAGGTGTTGGTAGA GATGTGTGAAAAGCATGTGGAAGTGACAGG 2014-07-19 2014-07-19
snp_cf0069000000008 YJ10 R CCTAGAATCCTTATGTTAGGTGTTGGTAGA GATGTGTGAAAAGCATGTGGAAGTGACAGG 2014-07-19 2014-07-19
6.Fasta Information
AACTGCCTGT AGACATAGGT CCTAGAATCC TTATGTTAGG TGTTGGTAGA
R
GATGTGTGAA AAGCATGTGG AAGTGACAGG CTTGTACTCT CATGTATCTC