e.g. 1:1246..9423
SNP Detail For snp_cf0075000000009    [See in GBrowse]
1.General Information
SNP ID: snp_cf0075000000009
Organism: Canis familiaris
Individual: YJ6
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: TCTCTCACAGTTCCACACGGCCTGCAGAGT
3'flank: TGTTTCGCACGTCTTCACCAGAGACGTTTG
3.Reference Map information
Chrom Position Reference YJ6
Chr1 30163 G T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0048000000006 LJ3 K TCTCTCACAGTTCCACACGGCCTGCAGAGT TGTTTCGCACGTCTTCACCAGAGACGTTTG 2014-07-19 2014-07-19
snp_cf0037000000005 KM2 K TCTCTCACAGTTCCACACGGCCTGCAGAGT TGTTTCGCACGTCTTCACCAGAGACGTTTG 2014-07-19 2014-07-19
snp_cf0038000000006 KM3 K TCTCTCACAGTTCCACACGGCCTGCAGAGT TGTTTCGCACGTCTTCACCAGAGACGTTTG 2014-07-19 2014-07-19
snp_cf0063000000004 TM4 K TCTCTCACAGTTCCACACGGCCTGCAGAGT TGTTTCGCACGTCTTCACCAGAGACGTTTG 2014-07-19 2014-07-19
snp_cf0061000000003 TM2 K TCTCTCACAGTTCCACACGGCCTGCAGAGT TGTTTCGCACGTCTTCACCAGAGACGTTTG 2014-07-19 2014-07-19
snp_cf0076000000004 YJ7 K TCTCTCACAGTTCCACACGGCCTGCAGAGT TGTTTCGCACGTCTTCACCAGAGACGTTTG 2014-07-19 2014-07-19
snp_cf0036000000007 KM1 K TCTCTCACAGTTCCACACGGCCTGCAGAGT TGTTTCGCACGTCTTCACCAGAGACGTTTG 2014-07-19 2014-07-19
snp_cf0034000000010 ISW T TCTCTCACAGTTCCACACGGCCTGCAGAGT TGTTTCGCACGTCTTCACCAGAGACGTTTG 2014-07-19 2014-07-19
6.Fasta Information
AGAGTTGAGC TCACCCTCAG TCTCTCACAG TTCCACACGG CCTGCAGAGT
T
TGTTTCGCAC GTCTTCACCA GAGACGTTTG CCAAAGGCTT GTGAGAGGCA