e.g. 1:1246..9423
SNP Detail For snp_cf0008004426309    [See in GBrowse]
1.General Information
SNP ID: snp_cf0008004426309
Organism: Canis familiaris
Individual: DQ10
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: GGTTCGCGTCCAGGAGGCCAGGATCCTGCA
3'flank: GACTGAAAGAGAGAACCGTGTGTGTCTCCT
3.Reference Map information
Chrom Position Reference DQ10
Chr8 191912 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000010670 4736 - G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000016964 577 CTG => TTG ENSCAFP00000015692 193 L => L
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0067004305000 TM8 R GGTTCGCGTCCAGGAGGCCAGGATCCTGCA GACTGAAAGAGAGAACCGTGTGTGTCTCCT 2014-07-19 2014-07-19
snp_cf0014004321570 DQ6 R GGTTCGCGTCCAGGAGGCCAGGATCCTGCA GACTGAAAGAGAGAACCGTGTGTGTCTCCT 2014-07-19 2014-07-19
snp_cf0064004395271 TM5 R GGTTCGCGTCCAGGAGGCCAGGATCCTGCA GACTGAAAGAGAGAACCGTGTGTGTCTCCT 2014-07-19 2014-07-19
snp_cf0063004281825 TM4 R GGTTCGCGTCCAGGAGGCCAGGATCCTGCA GACTGAAAGAGAGAACCGTGTGTGTCTCCT 2014-07-19 2014-07-19
snp_cf0062004366458 TM3 R GGTTCGCGTCCAGGAGGCCAGGATCCTGCA GACTGAAAGAGAGAACCGTGTGTGTCTCCT 2014-07-19 2014-07-19
snp_cf0072004479219 YJ3 R GGTTCGCGTCCAGGAGGCCAGGATCCTGCA GACTGAAAGAGAGAACCGTGTGTGTCTCCT 2014-07-19 2014-07-19
snp_cf0068004306824 TM9 R GGTTCGCGTCCAGGAGGCCAGGATCCTGCA GACTGAAAGAGAGAACCGTGTGTGTCTCCT 2014-07-19 2014-07-19
snp_cf0015004358886 DQ7 A GGTTCGCGTCCAGGAGGCCAGGATCCTGCA GACTGAAAGAGAGAACCGTGTGTGTCTCCT 2014-07-19 2014-07-19
6.Fasta Information
CACCTGCTGG GCGTCCCTCA GGTTCGCGTC CAGGAGGCCA GGATCCTGCA
R
GACTGAAAGA GAGAACCGTG TGTGTCTCCT TCTCCGTGGG CCGACTGTGG