e.g. 1:1246..9423
SNP Detail For snp_cf0008004426322    [See in GBrowse]
1.General Information
SNP ID: snp_cf0008004426322
Organism: Canis familiaris
Individual: DQ10
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: CCGGTGGCGGTGGCGGTGGCGGTGGCGGGG
3'flank: CCGCCGAGCCTGGCCGCCGCGGAGTCCGCC
3.Reference Map information
Chrom Position Reference DQ10
Chr8 196915 A R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000032126 264 + A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000049493 264 GGA => GGG ENSCAFP00000037817 88 G => G
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0010004377795 DQ2 G CCGGTGGCGGTGGCGGTGGCGGTGGCGGGG CCGCCGAGCCTGGCCGCCGCGGAGTCCGCC 2014-07-19 2014-07-19
snp_cf0067004305011 TM8 G CCGGTGGCGGTGGCGGTGGCGGTGGCGGGG CCGCCGAGCCTGGCCGCCGCGGAGTCCGCC 2014-07-19 2014-07-19
snp_cf0052004293712 LJ7 R CCGGTGGCGGTGGCGGTGGCGGTGGCGGGG CCGCCGAGCCTGGCCGCCGCGGAGTCCGCC 2014-07-19 2014-07-19
snp_cf0062004366471 TM3 G CCGGTGGCGGTGGCGGTGGCGGTGGCGGGG CCGCCGAGCCTGGCCGCCGCGGAGTCCGCC 2014-07-19 2014-07-19
snp_cf0077004439603 YJ8 G CCGGTGGCGGTGGCGGTGGCGGTGGCGGGG CCGCCGAGCCTGGCCGCCGCGGAGTCCGCC 2014-07-19 2014-07-19
snp_cf0070004608148 YJ1 G CCGGTGGCGGTGGCGGTGGCGGTGGCGGGG CCGCCGAGCCTGGCCGCCGCGGAGTCCGCC 2014-07-19 2014-07-19
snp_cf0075004459427 YJ6 G CCGGTGGCGGTGGCGGTGGCGGTGGCGGGG CCGCCGAGCCTGGCCGCCGCGGAGTCCGCC 2014-07-19 2014-07-19
snp_cf0078004445062 YJ9 G CCGGTGGCGGTGGCGGTGGCGGTGGCGGGG CCGCCGAGCCTGGCCGCCGCGGAGTCCGCC 2014-07-19 2014-07-19
snp_cf0063004281836 TM4 G CCGGTGGCGGTGGCGGTGGCGGTGGCGGGG CCGCCGAGCCTGGCCGCCGCGGAGTCCGCC 2014-07-19 2014-07-19
snp_cf0064004395284 TM5 G CCGGTGGCGGTGGCGGTGGCGGTGGCGGGG CCGCCGAGCCTGGCCGCCGCGGAGTCCGCC 2014-07-19 2014-07-19
snp_cf0060004269518 TM1 G CCGGTGGCGGTGGCGGTGGCGGTGGCGGGG CCGCCGAGCCTGGCCGCCGCGGAGTCCGCC 2014-07-19 2014-07-19
snp_cf0012004350943 DQ4 R CCGGTGGCGGTGGCGGTGGCGGTGGCGGGG CCGCCGAGCCTGGCCGCCGCGGAGTCCGCC 2014-07-19 2014-07-19
snp_cf0065004328897 TM6 G CCGGTGGCGGTGGCGGTGGCGGTGGCGGGG CCGCCGAGCCTGGCCGCCGCGGAGTCCGCC 2014-07-19 2014-07-19
snp_cf0076004483459 YJ7 G CCGGTGGCGGTGGCGGTGGCGGTGGCGGGG CCGCCGAGCCTGGCCGCCGCGGAGTCCGCC 2014-07-19 2014-07-19
snp_cf0073004353559 YJ4 G CCGGTGGCGGTGGCGGTGGCGGTGGCGGGG CCGCCGAGCCTGGCCGCCGCGGAGTCCGCC 2014-07-19 2014-07-19
snp_cf0040003765035 KM5 R CCGGTGGCGGTGGCGGTGGCGGTGGCGGGG CCGCCGAGCCTGGCCGCCGCGGAGTCCGCC 2014-07-19 2014-07-19
snp_cf0001001924529 solidGW1 G CCGGTGGCGGTGGCGGTGGCGGTGGCGGGG CCGCCGAGCCTGGCCGCCGCGGAGTCCGCC 2014-08-01 2014-08-01
snp_cf0016004360179 DQ8 R CCGGTGGCGGTGGCGGTGGCGGTGGCGGGG CCGCCGAGCCTGGCCGCCGCGGAGTCCGCC 2014-07-19 2014-07-19
snp_cf0069004487087 YJ10 G CCGGTGGCGGTGGCGGTGGCGGTGGCGGGG CCGCCGAGCCTGGCCGCCGCGGAGTCCGCC 2014-07-19 2014-07-19
snp_cf0066004466201 TM7 G CCGGTGGCGGTGGCGGTGGCGGTGGCGGGG CCGCCGAGCCTGGCCGCCGCGGAGTCCGCC 2014-07-19 2014-07-19
snp_cf0044003845419 KM9 G CCGGTGGCGGTGGCGGTGGCGGTGGCGGGG CCGCCGAGCCTGGCCGCCGCGGAGTCCGCC 2014-07-19 2014-07-19
snp_cf0074004380340 YJ5 R CCGGTGGCGGTGGCGGTGGCGGTGGCGGGG CCGCCGAGCCTGGCCGCCGCGGAGTCCGCC 2014-07-19 2014-07-19
snp_cf0059004350658 TM10 R CCGGTGGCGGTGGCGGTGGCGGTGGCGGGG CCGCCGAGCCTGGCCGCCGCGGAGTCCGCC 2014-07-19 2014-07-19
6.Fasta Information
CTCACCGCCC AGGCGCGTCC CCGGTGGCGG TGGCGGTGGC GGTGGCGGGG
R
CCGCCGAGCC TGGCCGCCGC GGAGTCCGCC GGACGCGCAG GAAAGGAAGG