e.g. 1:1246..9423
SNP Detail For snp_cf0008004426323    [See in GBrowse]
1.General Information
SNP ID: snp_cf0008004426323
Organism: Canis familiaris
Individual: DQ10
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT
3'flank: GGGGTGACACCCGACACCCCCGCCCCCGGC
3.Reference Map information
Chrom Position Reference DQ10
Chr8 197078 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000032126 427 + A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000049493 427 AGG => GGG ENSCAFP00000037817 143 R => G
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0010004377796 DQ2 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0024003428961 GS10 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0027003401043 GS3 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0077004439604 YJ8 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0078004445063 YJ9 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0043003676748 KM8 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0075004459428 YJ6 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0070004608149 YJ1 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0072004479232 YJ3 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0060004269519 TM1 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0071004450243 YJ2 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0055005386726 LUPWCHN00001 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0016004360180 DQ8 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0068004306836 TM9 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0040003765036 KM5 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0015004358898 DQ7 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0076004483460 YJ7 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0074004380341 YJ5 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0038003531470 KM3 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0059004350659 TM10 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0061004420298 TM2 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0052004293713 LJ7 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0062004366472 TM3 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0032003357574 GS8 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0063004281837 TM4 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0064004395285 TM5 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0073004353560 YJ4 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0044003845420 KM9 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0012004350944 DQ4 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0033003419615 GS9 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0065004328898 TM6 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0004003644667 Basenji G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0030003388820 GS6 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0039003686350 KM4 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0066004466202 TM7 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0037003627359 KM2 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0069004487088 YJ10 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0025003402440 GS1 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0035004236938 KM10 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0028003292797 GS4 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0029003209774 GS5 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0042004517289 KM7 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
snp_cf0036003477315 KM1 G CTCCCTCCGCCCCCGGCCGAGGTGTGCGCT GGGGTGACACCCGACACCCCCGCCCCCGGC 2014-07-19 2014-07-19
6.Fasta Information
CTCCTCGTCT CAGTGGTTCG CTCCCTCCGC CCCCGGCCGA GGTGTGCGCT
G
GGGGTGACAC CCGACACCCC CGCCCCCGGC GTGGTCCGGC CGGCGCGCCC