e.g. 1:1246..9423
SNP Detail For snp_cf0008004426439    [See in GBrowse]
1.General Information
SNP ID: snp_cf0008004426439
Organism: Canis familiaris
Individual: DQ10
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs24453624  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: CACCTCACACTGTTGCTGGGATCTGTCCAC
3'flank: CTTCTGACCTCCAGCAAGAGCCTCCGGGAG
3.Reference Map information
Chrom Position Reference DQ10
Chr8 309502 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000010686 56096 + A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000017002 2886 ACA => ACG ENSCAFP00000015730 962 T => T
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0057005164675 LUPWRUS00002 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0077004439703 YJ8 R CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0054004007784 LJ9 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0048004155470 LJ3 R CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0027003401146 GS3 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0076004483568 YJ7 R CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0060004269636 TM1 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0052004293849 LJ7 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0039003686485 KM4 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0055005386844 LUPWCHN00001 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0005005242647 CHW G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0012004351047 DQ4 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0067004305109 TM8 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0070004608250 YJ1 R CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0011004420491 DQ3 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0023004181715 FAMICHN00003 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0053004262399 LJ8 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0061004420395 TM2 R CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0015004358996 DQ7 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0068004306969 TM9 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0032003357676 GS8 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0017004406761 DQ9 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0073004353661 YJ4 R CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0075004459553 YJ6 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0041004330141 KM6 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0062004366573 TM3 R CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0014004321699 DQ6 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0021004182062 FAMICHN00001 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0020004311064 FAMBTIM00001 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0037003627491 KM2 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0065004329011 TM6 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0066004466300 TM7 R CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0028003292899 GS4 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0059004350787 TM10 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0045003997513 LJ10 R CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0040003765169 KM5 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0010004377909 DQ2 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0046004075945 LJ1 R CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0074004380442 YJ5 R CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0025003402542 GS1 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0047004240747 LJ2 R CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0072004479350 YJ3 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0031003440536 GS7 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0064004395410 TM5 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0044003845551 KM9 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0050004055185 LJ5 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0006005008083 CRW R CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0022003870453 FAMICHN00002 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0038003531572 KM3 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0042004517434 KM7 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0013004292824 DQ5 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0036003477447 KM1 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0018003626807 FAMBBEM00001 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0051004356289 LJ6 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0049004397505 LJ4 R CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0043003676879 KM8 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0009004357145 DQ1 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0003002494436 dbSNP139 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0024003429063 GS10 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0063004281939 TM4 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0033003419717 GS9 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0004003644765 Basenji G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0058005365997 LUPWRUS00003 R CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0030003388922 GS6 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0071004450337 YJ2 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0035004237069 KM10 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0026003424020 GS2 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0016004360300 DQ8 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0078004445164 YJ9 R CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0056005411299 LUPWRUS00001 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0019003390009 FAMBGSD00001 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0029003209876 GS5 G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
snp_cf0007003698725 Dingo G CACCTCACACTGTTGCTGGGATCTGTCCAC CTTCTGACCTCCAGCAAGAGCCTCCGGGAG 2014-07-19 2014-07-19
6.Fasta Information
AGATTGGATG GCTGTAGCCT CACCTCACAC TGTTGCTGGG ATCTGTCCAC
G
CTTCTGACCT CCAGCAAGAG CCTCCGGGAG CTAAGCCTGG GCAGCAATGA