e.g. 1:1246..9423
SNP Detail For snp_cf0008004426463    [See in GBrowse]
1.General Information
SNP ID: snp_cf0008004426463
Organism: Canis familiaris
Individual: DQ10
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs24491379  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: GCCTTCCTGGGACTGGATGGCCAGCACTGC
3'flank: TGGGCAATGTGGCTGTATGAAACAAGGATG
3.Reference Map information
Chrom Position Reference DQ10
Chr8 333078 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000010708 663 - T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000017035 663 CAA => CAG ENSCAFP00000015761 221 Q => Q
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0042004517462 KM7 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0063004281961 TM4 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0046004075967 LJ1 Y GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0037003627517 KM2 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0074004380463 YJ5 Y GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0010004377933 DQ2 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0036003477473 KM1 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0047004240769 LJ2 Y GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0025003402565 GS1 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0072004479373 YJ3 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0039003686515 KM4 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0050004055206 LJ5 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0064004395434 TM5 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0040003765194 KM5 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0022003870475 FAMICHN00002 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0038003531595 KM3 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0013004292848 DQ5 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0059004350812 TM10 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0006005008107 CRW Y GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0053004262423 LJ8 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0049004397526 LJ4 Y GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0030003388945 GS6 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0024003429085 GS10 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0035004237094 KM10 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0002002908882 CID1 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-08-02 2014-08-02
snp_cf0044003845577 KM9 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0033003419740 GS9 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0060004269660 TM1 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0071004450359 YJ2 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0004003644786 Basenji C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0026003424043 GS2 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0016004360323 DQ8 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0007003698745 Dingo C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0029003209899 GS5 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0018003626834 FAMBBEM00001 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0048004155493 LJ3 Y GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0012004351070 DQ4 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0015004359018 DQ7 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0067004305132 TM8 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0061004420417 TM2 Y GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0043003676904 KM8 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0078004445184 YJ9 Y GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0051004356314 LJ6 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0003002494464 dbSNP139 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0057005164698 LUPWRUS00002 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0014004321725 DQ6 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0009004357172 DQ1 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0068004306996 TM9 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0077004439726 YJ8 Y GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0054004007807 LJ9 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0055005386865 LUPWCHN00001 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0019003390032 FAMBGSD00001 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0058005366019 LUPWRUS00003 Y GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0011004420512 DQ3 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0028003292922 GS4 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0023004181737 FAMICHN00003 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0056005411320 LUPWRUS00001 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0070004608271 YJ1 Y GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0052004293877 LJ7 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0017004406784 DQ9 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0041004330167 KM6 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0075004459576 YJ6 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0001001924585 solidGW1 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-08-01 2014-08-01
snp_cf0032003357699 GS8 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0073004353681 YJ4 Y GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0062004366594 TM3 Y GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0020004311087 FAMBTIM00001 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0021004182085 FAMICHN00001 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0065004329032 TM6 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0031003440562 GS7 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0076004483593 YJ7 Y GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0066004466323 TM7 Y GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0027003401169 GS3 C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0005005242671 CHW C GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
snp_cf0045003997536 LJ10 Y GCCTTCCTGGGACTGGATGGCCAGCACTGC TGGGCAATGTGGCTGTATGAAACAAGGATG 2014-07-19 2014-07-19
6.Fasta Information
GTGTGGAAGG CCTTGCTCCT GCCTTCCTGG GACTGGATGG CCAGCACTGC
C
TGGGCAATGT GGCTGTATGA AACAAGGATG AGCAGCAGTG TCCCCATCAG