e.g. 1:1246..9423
SNP Detail For snp_cf0008004426464    [See in GBrowse]
1.General Information
SNP ID: snp_cf0008004426464
Organism: Canis familiaris
Individual: DQ10
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs9037193  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: AGATACCAACTTGTGACACAGAGGTGGGTT
3'flank: ACAATAACTGCATAGTGCAGAGGGCGGCAC
3.Reference Map information
Chrom Position Reference DQ10
Chr8 333339 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000010708 402 - C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000017035 402 GTG => GTA ENSCAFP00000015761 134 V => V
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0061004420418 TM2 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0042004517463 KM7 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0067004305133 TM8 T AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0046004075968 LJ1 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0074004380464 YJ5 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0003002494465 dbSNP139 T AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0037003627518 KM2 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0010004377934 DQ2 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0063004281962 TM4 T AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0071004450360 YJ2 T AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0014004321726 DQ6 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0050004055207 LJ5 T AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0009004357173 DQ1 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0072004479374 YJ3 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0068004306997 TM9 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0054004007808 LJ9 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0064004395435 TM5 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0040003765195 KM5 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0043003676905 KM8 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0013004292849 DQ5 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0059004350813 TM10 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0052004293878 LJ7 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0053004262424 LJ8 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0049004397527 LJ4 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0017004406785 DQ9 T AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0041004330168 KM6 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0062004366595 TM3 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0035004237095 KM10 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0020004311088 FAMBTIM00001 T AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0044003845578 KM9 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0021004182086 FAMICHN00001 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0004003644787 Basenji T AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0031003440563 GS7 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0060004269661 TM1 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0015004359019 DQ7 T AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0036003477474 KM1 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0016004360324 DQ8 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0018003626835 FAMBBEM00001 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0012004351071 DQ4 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
snp_cf0045003997537 LJ10 Y AGATACCAACTTGTGACACAGAGGTGGGTT ACAATAACTGCATAGTGCAGAGGGCGGCAC 2014-07-19 2014-07-19
6.Fasta Information
ACCTCACTGA CCCAGACCAG AGATACCAAC TTGTGACACA GAGGTGGGTT
Y
ACAATAACTG CATAGTGCAG AGGGCGGCAC ACCACCAAGT AGCGATCAAA