e.g. 1:1246..9423
SNP Detail For snp_cf0008000657610    [See in GBrowse]
1.General Information
SNP ID: snp_cf0008000657610
Organism: Canis familiaris
Individual: DQ10
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: CTTTGGCTCTGGGTGCGATCCTGGAGACCC
3'flank: GGATCGAGTCCCACATCGGGCTCCCAGAGC
3.Reference Map information
Chrom Position Reference DQ10
Chr13 3599 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0022000588111 FAMICHN00002 A CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0073000670460 YJ4 R CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0021000631536 FAMICHN00001 R CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0029000460424 GS5 R CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0031000525815 GS7 A CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0010000662969 DQ2 A CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0020000651167 FAMBTIM00001 A CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0012000661860 DQ4 R CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0023000620909 FAMICHN00003 R CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0051000663558 LJ6 A CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0024000538487 GS10 R CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0059000671765 TM10 R CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0048000630560 LJ3 R CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0046000599879 LJ1 A CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0030000527015 GS6 A CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0036000515686 KM1 A CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0064000671300 TM5 A CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0049000663468 LJ4 R CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0019000514138 FAMBGSD00001 R CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0074000671377 YJ5 A CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0070000697118 YJ1 A CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0075000683836 YJ6 R CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0076000680012 YJ7 A CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0011000668578 DQ3 R CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0057000816297 LUPWRUS00002 R CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0037000531008 KM2 A CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0054000590084 LJ9 R CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0009000663764 DQ1 R CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0033000521541 GS9 R CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0072000682889 YJ3 A CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0041000640993 KM6 R CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0052000641883 LJ7 R CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0065000643916 TM6 A CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0062000663965 TM3 R CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0044000584140 KM9 A CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0067000641042 TM8 R CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0077000675629 YJ8 A CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0069000684310 YJ10 A CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0060000674514 TM1 R CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0042000663819 KM7 R CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0017000674701 DQ9 A CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0035000632941 KM10 R CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0028000491891 GS4 R CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0032000501794 GS8 A CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0078000676604 YJ9 R CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0039000509054 KM4 R CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0026000495788 GS2 R CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0027000515265 GS3 R CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0040000580216 KM5 R CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0053000645072 LJ8 A CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0043000536910 KM8 A CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0013000632686 DQ5 R CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0038000542160 KM3 A CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0050000605545 LJ5 A CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
snp_cf0047000631199 LJ2 A CTTTGGCTCTGGGTGCGATCCTGGAGACCC GGATCGAGTCCCACATCGGGCTCCCAGAGC 2014-07-19 2014-07-19
6.Fasta Information
CGCAGCAGTT TGGCGCCTGC CTTTGGCTCT GGGTGCGATC CTGGAGACCC
R
GGATCGAGTC CCACATCGGG CTCCCAGAGC ATAGAGCCTG CTTCTCCCTC