e.g. 1:1246..9423
SNP Detail For snp_cf0008000657611    [See in GBrowse]
1.General Information
SNP ID: snp_cf0008000657611
Organism: Canis familiaris
Individual: DQ10
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: TCTCTGCCTCTCTCTCTCTCTGTGACTATC
3'flank: TAAATTAAAAAAAATTAACCCTATCCCTAA
3.Reference Map information
Chrom Position Reference DQ10
Chr13 3688 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0046000599880 LJ1 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0073000670461 YJ4 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0045000591908 LJ10 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0004000554065 Basenji G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0021000631537 FAMICHN00001 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0029000460425 GS5 R TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0015000664456 DQ7 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0031000525816 GS7 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0048000630561 LJ3 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0020000651168 FAMBTIM00001 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0012000661861 DQ4 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0055000831949 LUPWCHN00001 R TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0059000671766 TM10 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0051000663559 LJ6 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0024000538488 GS10 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0066000676624 TM7 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0036000515687 KM1 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0030000527016 GS6 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0006000768154 CRW G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0047000631200 LJ2 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0064000671301 TM5 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0019000514139 FAMBGSD00001 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0023000620910 FAMICHN00003 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0049000663469 LJ4 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0076000680013 YJ7 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0074000671378 YJ5 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0011000668579 DQ3 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0002000431561 CID1 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-08-02 2014-08-02
snp_cf0070000697119 YJ1 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0016000662168 DQ8 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0077000675630 YJ8 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0037000531009 KM2 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0057000816298 LUPWRUS00002 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0054000590085 LJ9 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0041000640994 KM6 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0009000663765 DQ1 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0033000521542 GS9 R TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0075000683837 YJ6 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0042000663820 KM7 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0044000584141 KM9 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0068000629040 TM9 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0022000588112 FAMICHN00002 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0007000554707 Dingo G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0052000641884 LJ7 R TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0071000674858 YJ2 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0062000663966 TM3 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0067000641043 TM8 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0018000551998 FAMBBEM00001 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0061000675059 TM2 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0069000684311 YJ10 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0065000643917 TM6 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0060000674515 TM1 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0017000674702 DQ9 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0028000491892 GS4 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0072000682890 YJ3 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0035000632942 KM10 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0032000501795 GS8 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0039000509055 KM4 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0026000495789 GS2 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0027000515266 GS3 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0078000676605 YJ9 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0040000580217 KM5 R TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0025000488539 GS1 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0058000833887 LUPWRUS00003 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0053000645073 LJ8 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0043000536911 KM8 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0063000653867 TM4 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0013000632687 DQ5 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0038000542161 KM3 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0034000782701 ISW G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0056000840586 LUPWRUS00001 R TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0050000605546 LJ5 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0010000662970 DQ2 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0005000813244 CHW G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
snp_cf0014000647264 DQ6 G TCTCTGCCTCTCTCTCTCTCTGTGACTATC TAAATTAAAAAAAATTAACCCTATCCCTAA 2014-07-19 2014-07-19
6.Fasta Information
TGCTTCTCCC TCTGCCTGTG TCTCTGCCTC TCTCTCTCTC TGTGACTATC
G
TAAATTAAAA AAAATTAACC CTATCCCTAA CCTCTAACCC TAACTTTAAC