e.g. 1:1246..9423
SNP Detail For snp_cf0008000657616    [See in GBrowse]
1.General Information
SNP ID: snp_cf0008000657616
Organism: Canis familiaris
Individual: DQ10
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: AATCCAACAGCGCAGACTGGGAGCACAGGG
3'flank: GCCGGGACAAAGCCCAGGATCCGGCCTCCC
3.Reference Map information
Chrom Position Reference DQ10
Chr13 7244 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0030000527022 GS6 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0040000580229 KM5 Y AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0063000653872 TM4 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0004000554069 Basenji C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0057000816304 LUPWRUS00002 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0025000488544 GS1 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0058000833893 LUPWRUS00003 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0037000531015 KM2 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0075000683842 YJ6 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0073000670466 YJ4 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0016000662173 DQ8 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0033000521555 GS9 Y AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0015000664461 DQ7 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0056000840598 LUPWRUS00001 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0009000663770 DQ1 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0012000661867 DQ4 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0076000680018 YJ7 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0021000631543 FAMICHN00001 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0064000671306 TM5 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0023000620916 FAMICHN00003 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0029000460437 GS5 Y AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0077000675635 YJ8 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0042000663827 KM7 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0036000515692 KM1 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0020000651174 FAMBTIM00001 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0011000668584 DQ3 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0078000676610 YJ9 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0027000515271 GS3 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0018000552003 FAMBBEM00001 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0041000641001 KM6 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0051000663563 LJ6 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0044000584147 KM9 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0049000663475 LJ4 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0068000629045 TM9 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0071000674865 YJ2 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0069000684316 YJ10 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0001000300803 solidGW1 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-08-01 2014-08-01
snp_cf0072000682898 YJ3 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0035000632949 KM10 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0017000674708 DQ9 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0074000671383 YJ5 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0028000491897 GS4 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0070000697126 YJ1 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0019000514147 FAMBGSD00001 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0002000431564 CID1 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-08-02 2014-08-02
snp_cf0007000554714 Dingo C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0005000813250 CHW C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0055000831961 LUPWCHN00001 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0031000525822 GS7 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0043000536917 KM8 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0065000643922 TM6 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0062000663974 TM3 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0060000674520 TM1 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0061000675065 TM2 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0013000632695 DQ5 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0052000641896 LJ7 Y AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0034000782706 ISW C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0010000662978 DQ2 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0059000671771 TM10 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0014000647269 DQ6 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0032000501801 GS8 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0067000641048 TM8 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0024000538495 GS10 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0038000542166 KM3 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0026000495796 GS2 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0066000676630 TM7 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
snp_cf0039000509060 KM4 C AATCCAACAGCGCAGACTGGGAGCACAGGG GCCGGGACAAAGCCCAGGATCCGGCCTCCC 2014-07-19 2014-07-19
6.Fasta Information
GCTCTGGGGC CGGAAGCGTG AATCCAACAG CGCAGACTGG GAGCACAGGG
C
GCCGGGACAA AGCCCAGGAT CCGGCCTCCC CCTGGGACAG GCAGAGGCCA