e.g. 1:1246..9423
SNP Detail For snp_cf0008000657617    [See in GBrowse]
1.General Information
SNP ID: snp_cf0008000657617
Organism: Canis familiaris
Individual: DQ10
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: GACCATCCTGCTAAAAGATGAAAGGGTCAA
3'flank: GAGGAAATTAAAGAAGTATTAAAAAGATTC
3.Reference Map information
Chrom Position Reference DQ10
Chr13 9771 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0030000527023 GS6 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0063000653874 TM4 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0046000599882 LJ1 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0025000488545 GS1 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0057000816306 LUPWRUS00002 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0058000833894 LUPWRUS00003 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0037000531016 KM2 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0016000662174 DQ8 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0075000683843 YJ6 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0073000670467 YJ4 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0053000645079 LJ8 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0048000630563 LJ3 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0033000521556 GS9 Y GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0015000664462 DQ7 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0009000663771 DQ1 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0012000661868 DQ4 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0014000647270 DQ6 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0076000680019 YJ7 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0047000631204 LJ2 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0077000675636 YJ8 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0021000631544 FAMICHN00001 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0006000768160 CRW C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0029000460438 GS5 Y GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0023000620918 FAMICHN00003 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0054000590087 LJ9 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0042000663828 KM7 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0036000515693 KM1 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0078000676612 YJ9 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0020000651175 FAMBTIM00001 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0011000668585 DQ3 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0064000671308 TM5 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0027000515272 GS3 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0018000552005 FAMBBEM00001 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0022000588117 FAMICHN00002 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0040000580230 KM5 Y GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0071000674866 YJ2 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0041000641002 KM6 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0051000663564 LJ6 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0044000584148 KM9 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0045000591910 LJ10 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0049000663476 LJ4 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0019000514148 FAMBGSD00001 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0069000684317 YJ10 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0017000674709 DQ9 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0028000491898 GS4 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0074000671384 YJ5 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0070000697127 YJ1 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0072000682899 YJ3 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0007000554715 Dingo C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0005000813251 CHW C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0050000605550 LJ5 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0031000525823 GS7 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0065000643924 TM6 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0062000663976 TM3 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0043000536919 KM8 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0004000554070 Basenji C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0061000675067 TM2 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0035000632950 KM10 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0052000641898 LJ7 Y GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0060000674521 TM1 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0034000782708 ISW C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0013000632696 DQ5 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0059000671772 TM10 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0010000662979 DQ2 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0024000538496 GS10 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0032000501802 GS8 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0026000495797 GS2 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0038000542167 KM3 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0039000509061 KM4 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0066000676632 TM7 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
snp_cf0067000641049 TM8 C GACCATCCTGCTAAAAGATGAAAGGGTCAA GAGGAAATTAAAGAAGTATTAAAAAGATTC 2014-07-19 2014-07-19
6.Fasta Information
TCAAACACGT GGAGGTGAAG GACCATCCTG CTAAAAGATG AAAGGGTCAA
C
GAGGAAATTA AAGAAGTATT AAAAAGATTC ATGGAAACTA ATGAGAATGA