e.g. 1:1246..9423
SNP Detail For snp_cf0008000657618    [See in GBrowse]
1.General Information
SNP ID: snp_cf0008000657618
Organism: Canis familiaris
Individual: DQ10
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: ACCATCCTGCTAAAAGATGAAAGGGTCAAT
3'flank: AGGAAATTAAAGAAGTATTAAAAAGATTCA
3.Reference Map information
Chrom Position Reference DQ10
Chr13 9772 G C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0058000833895 LUPWRUS00003 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0030000527024 GS6 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0046000599883 LJ1 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0053000645080 LJ8 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0025000488546 GS1 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0057000816307 LUPWRUS00002 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0075000683844 YJ6 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0076000680020 YJ7 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0037000531017 KM2 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0063000653875 TM4 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0073000670468 YJ4 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0016000662175 DQ8 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0033000521557 GS9 S ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0015000664463 DQ7 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0048000630564 LJ3 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0009000663772 DQ1 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0014000647271 DQ6 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0012000661869 DQ4 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0047000631205 LJ2 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0077000675637 YJ8 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0054000590088 LJ9 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0029000460439 GS5 S ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0021000631545 FAMICHN00001 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0023000620919 FAMICHN00003 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0042000663829 KM7 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0078000676613 YJ9 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0051000663565 LJ6 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0044000584149 KM9 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0011000668586 DQ3 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0020000651176 FAMBTIM00001 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0040000580231 KM5 S ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0022000588118 FAMICHN00002 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0064000671309 TM5 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0006000768161 CRW C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0027000515273 GS3 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0071000674867 YJ2 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0041000641003 KM6 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0045000591911 LJ10 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0036000515694 KM1 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0049000663477 LJ4 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0019000514149 FAMBGSD00001 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0018000552006 FAMBBEM00001 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0028000491899 GS4 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0043000536920 KM8 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0070000697128 YJ1 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0074000671385 YJ5 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0069000684318 YJ10 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0013000632697 DQ5 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0010000662980 DQ2 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0007000554716 Dingo C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0005000813252 CHW C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0067000641050 TM8 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0031000525824 GS7 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0065000643925 TM6 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0050000605551 LJ5 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0062000663977 TM3 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0061000675068 TM2 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0004000554071 Basenji C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0052000641899 LJ7 S ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0035000632951 KM10 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0060000674522 TM1 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0034000782709 ISW C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0017000674710 DQ9 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0059000671773 TM10 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0024000538497 GS10 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0072000682900 YJ3 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0026000495798 GS2 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0032000501803 GS8 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0066000676633 TM7 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0039000509062 KM4 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
snp_cf0038000542168 KM3 C ACCATCCTGCTAAAAGATGAAAGGGTCAAT AGGAAATTAAAGAAGTATTAAAAAGATTCA 2014-07-19 2014-07-19
6.Fasta Information
CAAACACGTG GAGGTGAAGG ACCATCCTGC TAAAAGATGA AAGGGTCAAT
C
AGGAAATTAA AGAAGTATTA AAAAGATTCA TGGAAACTAA TGAGAATGAA