e.g. 1:1246..9423
SNP Detail For snp_cf0009004496427    [See in GBrowse]
1.General Information
SNP ID: snp_cf0009004496427
Organism: Canis familiaris
Individual: DQ1
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: GAGCATGTTCTTCCTCCTGCCCCGTCAGGG
3'flank: GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC
3.Reference Map information
Chrom Position Reference DQ1
Chr9 164491 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000006048 28967 + A CDS
ENSCAFG00000005933 42226 + A intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000009779 1663 AGT => GGT ENSCAFP00000009078 555 S => G
+ ENSCAFT00000045577 859 AGT => GGT ENSCAFP00000038170 287 S => G
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0066004617029 TM7 R GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0059004498442 TM10 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0015004509848 DQ7 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0035004385769 KM10 R GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0076004634495 YJ7 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0021004322641 FAMICHN00001 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0012004502898 DQ4 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0061004569637 TM2 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0073004508510 YJ4 R GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0045004134335 LJ10 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0065004475563 TM6 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0017004555098 DQ9 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0044003976165 KM9 R GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0039003816425 KM4 R GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0016004507964 DQ8 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0060004411342 TM1 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0005005412442 CHW G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0026003549883 GS2 R GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0077004589140 YJ8 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0051004504854 LJ6 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0069004636378 YJ10 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0033003539235 GS9 R GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0078004591739 YJ9 R GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0072004630843 YJ3 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0057005332142 LUPWRUS00002 R GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0058005544110 LUPWRUS00003 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0025003519857 GS1 R GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0041004485421 KM6 R GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0037003765232 KM2 R GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0042004686275 KM7 R GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0028003409111 GS4 R GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0056005589979 LUPWRUS00001 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0001001991708 solidGW1 R GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-08-01 2014-08-01
snp_cf0054004147987 LJ9 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0068004454120 TM9 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0020004457240 FAMBTIM00001 R GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0036003584908 KM1 R GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0014004450813 DQ6 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0046004212787 LJ1 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0055005569385 LUPWCHN00001 R GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0023004315233 FAMICHN00003 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0011004570104 DQ3 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0034005212359 ISW G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0013004439375 DQ5 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0053004399346 LJ8 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0004003763490 Basenji G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0008004579914 DQ10 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0006005175752 CRW G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0010004520620 DQ2 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0063004424370 TM4 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0074004525112 YJ5 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0062004513855 TM3 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0027003519022 GS3 R GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0022003981957 FAMICHN00002 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0070004766340 YJ1 R GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0064004540429 TM5 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0067004450833 TM8 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0052004439907 LJ7 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
snp_cf0049004550449 LJ4 G GAGCATGTTCTTCCTCCTGCCCCGTCAGGG GTCAGGCCGGCGGCCCAGAAGAGCCCCGGC 2014-07-19 2014-07-19
6.Fasta Information
AAGAAATGGA GACTCTGAGT GAGCATGTTC TTCCTCCTGC CCCGTCAGGG
G
GTCAGGCCGG CGGCCCAGAA GAGCCCCGGC CACATCCAGA GGCAGCTGCC