e.g. 1:1246..9423
SNP Detail For snp_cf0009004496428    [See in GBrowse]
1.General Information
SNP ID: snp_cf0009004496428
Organism: Canis familiaris
Individual: DQ1
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: AGAGCCCCGGCCACATCCAGAGGCAGCTGC
3'flank: AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG
3.Reference Map information
Chrom Position Reference DQ1
Chr9 164541 C G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000006048 29017 + C CDS
ENSCAFG00000005933 42276 + C intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000009779 1713 GCC => GCG ENSCAFP00000009078 571 A => A
+ ENSCAFT00000045577 909 GCC => GCG ENSCAFP00000038170 303 A => A
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0076004634496 YJ7 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0059004498443 TM10 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0015004509849 DQ7 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0071004598844 YJ2 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0032003468101 GS8 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0021004322642 FAMICHN00001 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0012004502899 DQ4 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0031003559429 GS7 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0061004569638 TM2 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0065004475564 TM6 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0075004600785 YJ6 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0073004508511 YJ4 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0017004555099 DQ9 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0044003976166 KM9 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0039003816426 KM4 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0056005589980 LUPWRUS00001 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0060004411343 TM1 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0005005412443 CHW G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0016004507965 DQ8 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0049004550450 LJ4 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0033003539236 GS9 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0066004617030 TM7 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0069004636379 YJ10 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0026003549884 GS2 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0078004591740 YJ9 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0051004504855 LJ6 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0077004589141 YJ8 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0040003883582 KM5 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0072004630844 YJ3 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0035004385770 KM10 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0030003508377 GS6 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0037003765233 KM2 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0025003519858 GS1 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0057005332143 LUPWRUS00002 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0041004485422 KM6 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0028003409112 GS4 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0043003801550 KM8 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0042004686276 KM7 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0068004454121 TM9 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0001001991709 solidGW1 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-08-01 2014-08-01
snp_cf0020004457241 FAMBTIM00001 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0064004540430 TM5 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0055005569386 LUPWCHN00001 S AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0036003584909 KM1 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0006005175753 CRW G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0014004450814 DQ6 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0023004315234 FAMICHN00003 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0011004570105 DQ3 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0053004399347 LJ8 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0004003763491 Basenji G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0013004439376 DQ5 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0008004579915 DQ10 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0029003331464 GS5 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0010004520621 DQ2 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0007003822258 Dingo G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0038003634055 KM3 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0067004450834 TM8 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0063004424371 TM4 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0074004525113 YJ5 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0027003519023 GS3 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0062004513856 TM3 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0070004766341 YJ1 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0018003748247 FAMBBEM00001 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0024003543080 GS10 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0034005212360 ISW G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0019003499434 FAMBGSD00001 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
snp_cf0052004439908 LJ7 G AGAGCCCCGGCCACATCCAGAGGCAGCTGC AAGGCTCCTGGTGAGTGAGGGCAAGGGTGG 2014-07-19 2014-07-19
6.Fasta Information
AGTCAGGCCG GCGGCCCAGA AGAGCCCCGG CCACATCCAG AGGCAGCTGC
G
AAGGCTCCTG GTGAGTGAGG GCAAGGGTGG GGGCAGGGGC TACGGGTACG