e.g. 1:1246..9423
SNP Detail For snp_cf0009000802162    [See in GBrowse]
1.General Information
SNP ID: snp_cf0009000802162
Organism: Canis familiaris
Individual: DQ1
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: ATTGGGATTCAGGACACAAATTCATTTTCC
3'flank: GTCATTAATAAGCCAGCCAGTAATAATCTA
3.Reference Map information
Chrom Position Reference DQ1
Chr14 2651 T Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0049000805566 LJ4 Y ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0015000802429 DQ7 C ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0045000709824 LJ10 Y ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0004000659189 Basenji Y ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0039000619828 KM4 C ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0065000779932 TM6 C ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0057000983029 LUPWRUS00002 Y ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0036000634860 KM1 Y ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0034000944104 ISW C ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0060000804042 TM1 Y ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0064000808904 TM5 C ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0054000720733 LJ9 C ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0005000990976 CHW Y ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0059000811348 TM10 Y ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0058001004408 LUPWRUS00003 Y ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0017000814765 DQ9 C ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0068000770152 TM9 Y ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0043000656114 KM8 Y ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0047000767102 LJ2 Y ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0013000773202 DQ5 C ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0073000813635 YJ4 Y ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0067000777899 TM8 Y ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0010000799950 DQ2 C ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0061000811432 TM2 C ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0014000788193 DQ6 Y ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0021000761289 FAMICHN00001 C ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0052000776706 LJ7 C ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0074000811306 YJ5 C ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0020000792079 FAMBTIM00001 C ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0016000795312 DQ8 C ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0075000825061 YJ6 Y ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0066000814971 TM7 C ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0008000785249 DQ10 C ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0055001003592 LUPWCHN00001 Y ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0070000841106 YJ1 Y ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0076000820725 YJ7 Y ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0051000800301 LJ6 Y ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0056001015125 LUPWRUS00001 C ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0072000823718 YJ3 Y ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0078000815387 YJ9 Y ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0048000760111 LJ3 Y ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0006000919705 CRW Y ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0053000776875 LJ8 Y ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0012000802962 DQ4 C ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0063000790696 TM4 C ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0077000817676 YJ8 Y ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
snp_cf0071000817051 YJ2 C ATTGGGATTCAGGACACAAATTCATTTTCC GTCATTAATAAGCCAGCCAGTAATAATCTA 2014-07-19 2014-07-19
6.Fasta Information
TAATTAAATA GATATATATA ATTGGGATTC AGGACACAAA TTCATTTTCC
Y
GTCATTAATA AGCCAGCCAG TAATAATCTA TGTTATATTA TATATATATA