e.g. 1:1246..9423
SNP Detail For snp_cf0009000802164    [See in GBrowse]
1.General Information
SNP ID: snp_cf0009000802164
Organism: Canis familiaris
Individual: DQ1
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: TGTCTGAAAACTACTATGTACTTTTTTCTC
3'flank: GGAATTTCTCATATCTAGAAGTCTCTGTTA
3.Reference Map information
Chrom Position Reference DQ1
Chr14 6661 T Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000009505 181 + T NON_CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0008000785253 DQ10 C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0070000841110 YJ1 C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0036000634864 KM1 C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0048000760113 LJ3 C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0049000805569 LJ4 Y TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0077000817680 YJ8 C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0060000804046 TM1 Y TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0055001003594 LUPWCHN00001 C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0064000808908 TM5 C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0016000795315 DQ8 C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0013000773205 DQ5 C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0043000656117 KM8 Y TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0054000720737 LJ9 C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0005000990978 CHW C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0017000814769 DQ9 C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0072000823722 YJ3 C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0015000802433 DQ7 C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0047000767105 LJ2 Y TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0078000815391 YJ9 C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0062000803961 TM3 C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0063000790700 TM4 Y TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0010000799954 DQ2 C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0004000659194 Basenji C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0075000825065 YJ6 C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0061000811435 TM2 C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0074000811309 YJ5 C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0076000820728 YJ7 C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0051000800303 LJ6 Y TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0056001015128 LUPWRUS00001 C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0039000619831 KM4 C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0066000814975 TM7 C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0014000788197 DQ6 Y TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0058001004411 LUPWRUS00003 C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0034000944107 ISW Y TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0071000817054 YJ2 C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0006000919708 CRW C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0052000776709 LJ7 C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0067000777902 TM8 Y TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0053000776879 LJ8 Y TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0021000761292 FAMICHN00001 C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0020000792082 FAMBTIM00001 C TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
snp_cf0059000811351 TM10 Y TGTCTGAAAACTACTATGTACTTTTTTCTC GGAATTTCTCATATCTAGAAGTCTCTGTTA 2014-07-19 2014-07-19
6.Fasta Information
CCCTCACATT TGTAGATTCT TGTCTGAAAA CTACTATGTA CTTTTTTCTC
Y
GGAATTTCTC ATATCTAGAA GTCTCTGTTA CCACTGTCTG TATTCTGATA