e.g. 1:1246..9423
SNP Detail For snp_cf0009003680706    [See in GBrowse]
1.General Information
SNP ID: snp_cf0009003680706
Organism: Canis familiaris
Individual: DQ1
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: W
5'flank: TGACAGTGGGCTTCACCCTGGAAGAGTGGC
3'flank: GCACCTGGACTCAACTCAGAGGTCCTTATA
3.Reference Map information
Chrom Position Reference DQ1
Chr4 363672 A W
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000029103 14614 + A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000049444 86 CAG => CTG ENSCAFP00000042762 29 Q => L
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0052003628720 LJ7 W TGACAGTGGGCTTCACCCTGGAAGAGTGGC GCACCTGGACTCAACTCAGAGGTCCTTATA 2014-07-19 2014-07-19
snp_cf0068003653478 TM9 T TGACAGTGGGCTTCACCCTGGAAGAGTGGC GCACCTGGACTCAACTCAGAGGTCCTTATA 2014-07-19 2014-07-19
snp_cf0020003659378 FAMBTIM00001 W TGACAGTGGGCTTCACCCTGGAAGAGTGGC GCACCTGGACTCAACTCAGAGGTCCTTATA 2014-07-19 2014-07-19
snp_cf0014003661074 DQ6 W TGACAGTGGGCTTCACCCTGGAAGAGTGGC GCACCTGGACTCAACTCAGAGGTCCTTATA 2014-07-19 2014-07-19
snp_cf0044003254878 KM9 W TGACAGTGGGCTTCACCCTGGAAGAGTGGC GCACCTGGACTCAACTCAGAGGTCCTTATA 2014-07-19 2014-07-19
snp_cf0070003913259 YJ1 W TGACAGTGGGCTTCACCCTGGAAGAGTGGC GCACCTGGACTCAACTCAGAGGTCCTTATA 2014-07-19 2014-07-19
snp_cf0054003381251 LJ9 W TGACAGTGGGCTTCACCCTGGAAGAGTGGC GCACCTGGACTCAACTCAGAGGTCCTTATA 2014-07-19 2014-07-19
snp_cf0017003742250 DQ9 T TGACAGTGGGCTTCACCCTGGAAGAGTGGC GCACCTGGACTCAACTCAGAGGTCCTTATA 2014-07-19 2014-07-19
snp_cf0047003590472 LJ2 W TGACAGTGGGCTTCACCCTGGAAGAGTGGC GCACCTGGACTCAACTCAGAGGTCCTTATA 2014-07-19 2014-07-19
snp_cf0060003607265 TM1 W TGACAGTGGGCTTCACCCTGGAAGAGTGGC GCACCTGGACTCAACTCAGAGGTCCTTATA 2014-07-19 2014-07-19
snp_cf0046003440795 LJ1 W TGACAGTGGGCTTCACCCTGGAAGAGTGGC GCACCTGGACTCAACTCAGAGGTCCTTATA 2014-07-19 2014-07-19
snp_cf0066003784513 TM7 W TGACAGTGGGCTTCACCCTGGAAGAGTGGC GCACCTGGACTCAACTCAGAGGTCCTTATA 2014-07-19 2014-07-19
snp_cf0015003681163 DQ7 W TGACAGTGGGCTTCACCCTGGAAGAGTGGC GCACCTGGACTCAACTCAGAGGTCCTTATA 2014-07-19 2014-07-19
snp_cf0043003104892 KM8 W TGACAGTGGGCTTCACCCTGGAAGAGTGGC GCACCTGGACTCAACTCAGAGGTCCTTATA 2014-07-19 2014-07-19
snp_cf0059003694152 TM10 W TGACAGTGGGCTTCACCCTGGAAGAGTGGC GCACCTGGACTCAACTCAGAGGTCCTTATA 2014-07-19 2014-07-19
snp_cf0073003714456 YJ4 W TGACAGTGGGCTTCACCCTGGAAGAGTGGC GCACCTGGACTCAACTCAGAGGTCCTTATA 2014-07-19 2014-07-19
snp_cf0035003580813 KM10 W TGACAGTGGGCTTCACCCTGGAAGAGTGGC GCACCTGGACTCAACTCAGAGGTCCTTATA 2014-07-19 2014-07-19
6.Fasta Information
ATCAGTATCA TTTAAGGATG TGACAGTGGG CTTCACCCTG GAAGAGTGGC
W
GCACCTGGAC TCAACTCAGA GGTCCTTATA TAGAGATGTG ATGCTGGAGA