e.g. 1:1246..9423
SNP Detail For snp_cf0009003680743    [See in GBrowse]
1.General Information
SNP ID: snp_cf0009003680743
Organism: Canis familiaris
Individual: DQ1
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: CAGCCGCAGTCCCAGGCCTACATTCTGAGA
3'flank: ACGAGGGTGACTTTTACTACTCAGGGGGCT
3.Reference Map information
Chrom Position Reference DQ1
Chr4 411699 A R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000024143 944 + A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000037355 616 AAC => GAC ENSCAFP00000032845 206 N => D
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0056004582620 LUPWRUS00001 G CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0052003628767 LJ7 G CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0067003640324 TM8 R CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0062003694444 TM3 R CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0044003254923 KM9 G CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0028002799163 GS4 R CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0054003381285 LJ9 G CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0064003723043 TM5 G CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0071003779486 YJ2 G CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0077003764080 YJ8 R CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0012003690308 DQ4 R CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0001001610432 solidGW1 G CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-08-01 2014-08-01
snp_cf0033002909758 GS9 R CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0061003745637 TM2 G CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0076003804375 YJ7 G CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0058004547830 LUPWRUS00003 G CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0030002879873 GS6 R CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0043003104929 KM8 R CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0055004560259 LUPWCHN00001 G CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0020003659414 FAMBTIM00001 G CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0048003516547 LJ3 G CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0016003695412 DQ8 R CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0078003775587 YJ9 R CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0029002728911 GS5 G CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0047003590525 LJ2 G CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0057004365618 LUPWRUS00002 G CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0068003653513 TM9 G CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0059003694188 TM10 R CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0004003087927 Basenji G CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0035003580850 KM10 G CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0008003742880 DQ10 R CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0051003689961 LJ6 G CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0022003292443 FAMICHN00002 G CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0066003784550 TM7 G CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0060003607302 TM1 R CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0007003133429 Dingo R CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0017003742287 DQ9 G CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0006004248925 CRW G CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0014003661109 DQ6 R CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0015003681201 DQ7 R CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0005004405013 CHW G CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0021003538941 FAMICHN00001 R CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0023003524248 FAMICHN00003 R CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0018003066980 FAMBBEM00001 R CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0070003913297 YJ1 R CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0074003720388 YJ5 G CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0013003619805 DQ5 G CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0010003706267 DQ2 R CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0072003790783 YJ3 R CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0075003782904 YJ6 R CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0069003812593 YJ10 G CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0053003607150 LJ8 R CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0049003715119 LJ4 G CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
snp_cf0073003714501 YJ4 G CAGCCGCAGTCCCAGGCCTACATTCTGAGA ACGAGGGTGACTTTTACTACTCAGGGGGCT 2014-07-19 2014-07-19
6.Fasta Information
AGGCCTTCAC CTACGAGCTC CAGCCGCAGT CCCAGGCCTA CATTCTGAGA
R
ACGAGGGTGA CTTTTACTAC TCAGGGGGCT TTTTCGGGGG GTCGGTGGTC