e.g. 1:1246..9423
SNP Detail For snp_cf0009003683000    [See in GBrowse]
1.General Information
SNP ID: snp_cf0009003683000
Organism: Canis familiaris
Individual: DQ1
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: AAGTTTGCTGAGCTGAAGGAGAAGATAGAT
3'flank: GTCGTTCTGGAAAGAAGCTGGAAGATGGTC
3.Reference Map information
Chrom Position Reference DQ1
Chr4 2640831 T Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000008063 1131 + T CDS
ENSCAFG00000010034 458867 - T intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000012863 1069 TGT => CGT ENSCAFP00000032652 357 C => R
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0071003781495 YJ2 C AAGTTTGCTGAGCTGAAGGAGAAGATAGAT GTCGTTCTGGAAAGAAGCTGGAAGATGGTC 2014-07-19 2014-07-19
snp_cf0008003744107 DQ10 Y AAGTTTGCTGAGCTGAAGGAGAAGATAGAT GTCGTTCTGGAAAGAAGCTGGAAGATGGTC 2014-07-19 2014-07-19
snp_cf0066003786651 TM7 Y AAGTTTGCTGAGCTGAAGGAGAAGATAGAT GTCGTTCTGGAAAGAAGCTGGAAGATGGTC 2014-07-19 2014-07-19
snp_cf0060003609766 TM1 Y AAGTTTGCTGAGCTGAAGGAGAAGATAGAT GTCGTTCTGGAAAGAAGCTGGAAGATGGTC 2014-07-19 2014-07-19
snp_cf0005004407590 CHW Y AAGTTTGCTGAGCTGAAGGAGAAGATAGAT GTCGTTCTGGAAAGAAGCTGGAAGATGGTC 2014-07-19 2014-07-19
snp_cf0020003661621 FAMBTIM00001 Y AAGTTTGCTGAGCTGAAGGAGAAGATAGAT GTCGTTCTGGAAAGAAGCTGGAAGATGGTC 2014-07-19 2014-07-19
snp_cf0007003135401 Dingo Y AAGTTTGCTGAGCTGAAGGAGAAGATAGAT GTCGTTCTGGAAAGAAGCTGGAAGATGGTC 2014-07-19 2014-07-19
snp_cf0073003716437 YJ4 Y AAGTTTGCTGAGCTGAAGGAGAAGATAGAT GTCGTTCTGGAAAGAAGCTGGAAGATGGTC 2014-07-19 2014-07-19
snp_cf0012003692778 DQ4 Y AAGTTTGCTGAGCTGAAGGAGAAGATAGAT GTCGTTCTGGAAAGAAGCTGGAAGATGGTC 2014-07-19 2014-07-19
snp_cf0059003696633 TM10 C AAGTTTGCTGAGCTGAAGGAGAAGATAGAT GTCGTTCTGGAAAGAAGCTGGAAGATGGTC 2014-07-19 2014-07-19
snp_cf0063003638683 TM4 Y AAGTTTGCTGAGCTGAAGGAGAAGATAGAT GTCGTTCTGGAAAGAAGCTGGAAGATGGTC 2014-07-19 2014-07-19
snp_cf0011003752310 DQ3 Y AAGTTTGCTGAGCTGAAGGAGAAGATAGAT GTCGTTCTGGAAAGAAGCTGGAAGATGGTC 2014-07-19 2014-07-19
snp_cf0075003784226 YJ6 Y AAGTTTGCTGAGCTGAAGGAGAAGATAGAT GTCGTTCTGGAAAGAAGCTGGAAGATGGTC 2014-07-19 2014-07-19
snp_cf0023003526147 FAMICHN00003 C AAGTTTGCTGAGCTGAAGGAGAAGATAGAT GTCGTTCTGGAAAGAAGCTGGAAGATGGTC 2014-07-19 2014-07-19
snp_cf0033002911379 GS9 Y AAGTTTGCTGAGCTGAAGGAGAAGATAGAT GTCGTTCTGGAAAGAAGCTGGAAGATGGTC 2014-07-19 2014-07-19
snp_cf0067003642315 TM8 Y AAGTTTGCTGAGCTGAAGGAGAAGATAGAT GTCGTTCTGGAAAGAAGCTGGAAGATGGTC 2014-07-19 2014-07-19
snp_cf0022003294123 FAMICHN00002 Y AAGTTTGCTGAGCTGAAGGAGAAGATAGAT GTCGTTCTGGAAAGAAGCTGGAAGATGGTC 2014-07-19 2014-07-19
snp_cf0006004250263 CRW C AAGTTTGCTGAGCTGAAGGAGAAGATAGAT GTCGTTCTGGAAAGAAGCTGGAAGATGGTC 2014-07-19 2014-07-19
snp_cf0070003915437 YJ1 Y AAGTTTGCTGAGCTGAAGGAGAAGATAGAT GTCGTTCTGGAAAGAAGCTGGAAGATGGTC 2014-07-19 2014-07-19
snp_cf0068003655208 TM9 C AAGTTTGCTGAGCTGAAGGAGAAGATAGAT GTCGTTCTGGAAAGAAGCTGGAAGATGGTC 2014-07-19 2014-07-19
snp_cf0030002881497 GS6 Y AAGTTTGCTGAGCTGAAGGAGAAGATAGAT GTCGTTCTGGAAAGAAGCTGGAAGATGGTC 2014-07-19 2014-07-19
snp_cf0017003744773 DQ9 Y AAGTTTGCTGAGCTGAAGGAGAAGATAGAT GTCGTTCTGGAAAGAAGCTGGAAGATGGTC 2014-07-19 2014-07-19
snp_cf0053003608863 LJ8 Y AAGTTTGCTGAGCTGAAGGAGAAGATAGAT GTCGTTCTGGAAAGAAGCTGGAAGATGGTC 2014-07-19 2014-07-19
snp_cf0072003792285 YJ3 Y AAGTTTGCTGAGCTGAAGGAGAAGATAGAT GTCGTTCTGGAAAGAAGCTGGAAGATGGTC 2014-07-19 2014-07-19
snp_cf0078003776439 YJ9 Y AAGTTTGCTGAGCTGAAGGAGAAGATAGAT GTCGTTCTGGAAAGAAGCTGGAAGATGGTC 2014-07-19 2014-07-19
snp_cf0064003725175 TM5 Y AAGTTTGCTGAGCTGAAGGAGAAGATAGAT GTCGTTCTGGAAAGAAGCTGGAAGATGGTC 2014-07-19 2014-07-19
snp_cf0028002800794 GS4 Y AAGTTTGCTGAGCTGAAGGAGAAGATAGAT GTCGTTCTGGAAAGAAGCTGGAAGATGGTC 2014-07-19 2014-07-19
snp_cf0034004268519 ISW C AAGTTTGCTGAGCTGAAGGAGAAGATAGAT GTCGTTCTGGAAAGAAGCTGGAAGATGGTC 2014-07-19 2014-07-19
snp_cf0029002729547 GS5 C AAGTTTGCTGAGCTGAAGGAGAAGATAGAT GTCGTTCTGGAAAGAAGCTGGAAGATGGTC 2014-07-19 2014-07-19
6.Fasta Information
ACACAGCTCA CATTGCTTGC AAGTTTGCTG AGCTGAAGGA GAAGATAGAT
Y
GTCGTTCTGG AAAGAAGCTG GAAGATGGTC CCAAGTTCTT GAAATCTGGG