e.g. 1:1246..9423
SNP Detail For snp_cf0009003684005    [See in GBrowse]
1.General Information
SNP ID: snp_cf0009003684005
Organism: Canis familiaris
Individual: DQ1
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: M
5'flank: GAGCTGATGATGGACAGAGAAATACCAGTG
3'flank: AACTGTGGGCACATTACATAGAGCAGCTCA
3.Reference Map information
Chrom Position Reference DQ1
Chr4 3519446 C M
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000010919 18300 + C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000017410 2296 CAA => AAA ENSCAFP00000016119 766 Q => K
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0059003697689 TM10 M GAGCTGATGATGGACAGAGAAATACCAGTG AACTGTGGGCACATTACATAGAGCAGCTCA 2014-07-19 2014-07-19
snp_cf0017003745760 DQ9 M GAGCTGATGATGGACAGAGAAATACCAGTG AACTGTGGGCACATTACATAGAGCAGCTCA 2014-07-19 2014-07-19
snp_cf0060003610540 TM1 M GAGCTGATGATGGACAGAGAAATACCAGTG AACTGTGGGCACATTACATAGAGCAGCTCA 2014-07-19 2014-07-19
snp_cf0068003655928 TM9 A GAGCTGATGATGGACAGAGAAATACCAGTG AACTGTGGGCACATTACATAGAGCAGCTCA 2014-07-19 2014-07-19
6.Fasta Information
TCTCCTCAGA ATGGCATTTT GAGCTGATGA TGGACAGAGA AATACCAGTG
M
AACTGTGGGC ACATTACATA GAGCAGCTCA ACGCTGCCCA GCGTGTTGTT