e.g. 1:1246..9423
SNP Detail For snp_cf0009003684472    [See in GBrowse]
1.General Information
SNP ID: snp_cf0009003684472
Organism: Canis familiaris
Individual: DQ1
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs9017161  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: GAGAACACATCCTCCGGGCAGCGGGGCTGA
3'flank: GGACCCACAGCAGCCCGTGATGCCGGGCCT
3.Reference Map information
Chrom Position Reference DQ1
Chr4 4001596 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000011196 66429 + C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000017814 2579 ACG => ATG ENSCAFP00000016492 860 T => M
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0003002124158 dbSNP139 T GAGAACACATCCTCCGGGCAGCGGGGCTGA GGACCCACAGCAGCCCGTGATGCCGGGCCT 2014-07-19 2014-07-19
snp_cf0004003089010 Basenji T GAGAACACATCCTCCGGGCAGCGGGGCTGA GGACCCACAGCAGCCCGTGATGCCGGGCCT 2014-07-19 2014-07-19
snp_cf0025002883134 GS1 Y GAGAACACATCCTCCGGGCAGCGGGGCTGA GGACCCACAGCAGCCCGTGATGCCGGGCCT 2014-07-19 2014-07-19
snp_cf0014003664244 DQ6 T GAGAACACATCCTCCGGGCAGCGGGGCTGA GGACCCACAGCAGCCCGTGATGCCGGGCCT 2014-07-19 2014-07-19
snp_cf0064003726867 TM5 Y GAGAACACATCCTCCGGGCAGCGGGGCTGA GGACCCACAGCAGCCCGTGATGCCGGGCCT 2014-07-19 2014-07-19
snp_cf0065003679357 TM6 Y GAGAACACATCCTCCGGGCAGCGGGGCTGA GGACCCACAGCAGCCCGTGATGCCGGGCCT 2014-07-19 2014-07-19
snp_cf0026002901237 GS2 Y GAGAACACATCCTCCGGGCAGCGGGGCTGA GGACCCACAGCAGCCCGTGATGCCGGGCCT 2014-07-19 2014-07-19
6.Fasta Information
AACCCGATGT CAGCTGGAGA GAGAACACAT CCTCCGGGCA GCGGGGCTGA
Y
GGACCCACAG CAGCCCGTGA TGCCGGGCCT GTTTGTTCCC GAGTGTGACG