e.g. 1:1246..9423
SNP Detail For snp_cf0009003684702    [See in GBrowse]
1.General Information
SNP ID: snp_cf0009003684702
Organism: Canis familiaris
Individual: DQ1
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs24110192  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: GGCTTCAGTGTCTCCCTGTGGTTTAACATC
3'flank: AGTGCATCCAGGAAGCTGAGAGCATCATGG
3.Reference Map information
Chrom Position Reference DQ1
Chr4 4166489 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000011231 59706 + A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000017844 4441 AAG => GAG ENSCAFP00000016519 1481 K => E
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0007003136761 Dingo G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0044003258883 KM9 R GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0077003767548 YJ8 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0011003753871 DQ3 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0078003778011 YJ9 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0006004251408 CRW G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0049003717718 LJ4 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0076003807596 YJ7 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0027002897655 GS3 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0004003089051 Basenji G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0045003371559 LJ10 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0059003698408 TM10 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0072003794018 YJ3 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0010003709816 DQ2 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0048003518739 LJ3 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0014003664313 DQ6 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0026002901308 GS2 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0058004551142 LUPWRUS00003 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0029002730664 GS5 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0071003782789 YJ2 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0024002914488 GS10 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0003002124282 dbSNP139 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0040003209650 KM5 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0068003656572 TM9 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0050003435731 LJ5 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0034004269658 ISW G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0036002933323 KM1 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0051003693484 LJ6 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0018003069276 FAMBBEM00001 R GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0075003785912 YJ6 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0019002875133 FAMBGSD00001 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0073003718013 YJ4 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0070003917156 YJ1 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0008003745761 DQ10 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0020003662909 FAMBTIM00001 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0074003723474 YJ5 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0065003679435 TM6 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0023003527816 FAMICHN00003 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0060003611228 TM1 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0013003624020 DQ5 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0033002912628 GS9 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0042003855084 KM7 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0015003684767 DQ7 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0069003815245 YJ10 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0005004409588 CHW G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0053003610498 LJ8 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0063003639644 TM4 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0025002883204 GS1 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0022003295560 FAMICHN00002 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0052003631354 LJ7 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0031002933232 GS7 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0037003084726 KM2 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0062003697971 TM3 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0067003643770 TM8 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0039003109544 KM4 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0061003749487 TM2 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0038002976138 KM3 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0066003788474 TM7 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0047003594295 LJ2 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0032002859190 GS8 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0028002802044 GS4 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0041003698864 KM6 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0055004564198 LUPWCHN00001 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0043003107322 KM8 R GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0056004586699 LUPWRUS00001 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0030002882747 GS6 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0021003541750 FAMICHN00001 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0054003384203 LJ9 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0016003699120 DQ8 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0012003694351 DQ4 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0064003727079 TM5 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0035003583574 KM10 R GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0017003746493 DQ9 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0057004369317 LUPWRUS00002 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
snp_cf0046003444548 LJ1 G GGCTTCAGTGTCTCCCTGTGGTTTAACATC AGTGCATCCAGGAAGCTGAGAGCATCATGG 2014-07-19 2014-07-19
6.Fasta Information
GCTGGCCTCA CCTGTCAGAA GGCTTCAGTG TCTCCCTGTG GTTTAACATC
G
AGTGCATCCA GGAAGCTGAG AGCATCATGG AGAAAGGAAA GAAGATCAAG