e.g. 1:1246..9423
SNP Detail For snp_cf0034000000011    [See in GBrowse]
1.General Information
SNP ID: snp_cf0034000000011
Organism: Canis familiaris
Individual: ISW
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: A
5'flank: TTCCACACGGCCTGCAGAGTGTGTTTCGCA
3'flank: GTCTTCACCAGAGACGTTTGCCAAAGGCTT
3.Reference Map information
Chrom Position Reference ISW
Chr1 30173 C A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0061000000004 TM2 M TTCCACACGGCCTGCAGAGTGTGTTTCGCA GTCTTCACCAGAGACGTTTGCCAAAGGCTT 2014-07-19 2014-07-19
snp_cf0075000000010 YJ6 A TTCCACACGGCCTGCAGAGTGTGTTTCGCA GTCTTCACCAGAGACGTTTGCCAAAGGCTT 2014-07-19 2014-07-19
snp_cf0037000000006 KM2 M TTCCACACGGCCTGCAGAGTGTGTTTCGCA GTCTTCACCAGAGACGTTTGCCAAAGGCTT 2014-07-19 2014-07-19
snp_cf0048000000007 LJ3 M TTCCACACGGCCTGCAGAGTGTGTTTCGCA GTCTTCACCAGAGACGTTTGCCAAAGGCTT 2014-07-19 2014-07-19
snp_cf0063000000005 TM4 M TTCCACACGGCCTGCAGAGTGTGTTTCGCA GTCTTCACCAGAGACGTTTGCCAAAGGCTT 2014-07-19 2014-07-19
snp_cf0036000000008 KM1 M TTCCACACGGCCTGCAGAGTGTGTTTCGCA GTCTTCACCAGAGACGTTTGCCAAAGGCTT 2014-07-19 2014-07-19
snp_cf0077000000009 YJ8 M TTCCACACGGCCTGCAGAGTGTGTTTCGCA GTCTTCACCAGAGACGTTTGCCAAAGGCTT 2014-07-19 2014-07-19
snp_cf0038000000007 KM3 M TTCCACACGGCCTGCAGAGTGTGTTTCGCA GTCTTCACCAGAGACGTTTGCCAAAGGCTT 2014-07-19 2014-07-19
snp_cf0076000000005 YJ7 M TTCCACACGGCCTGCAGAGTGTGTTTCGCA GTCTTCACCAGAGACGTTTGCCAAAGGCTT 2014-07-19 2014-07-19
6.Fasta Information
TCACCCTCAG TCTCTCACAG TTCCACACGG CCTGCAGAGT GTGTTTCGCA
A
GTCTTCACCA GAGACGTTTG CCAAAGGCTT GTGAGAGGCA ACTTAACAAT