e.g. 1:1246..9423
SNP Detail For snp_cf0049000000074    [See in GBrowse]
1.General Information
SNP ID: snp_cf0049000000074
Organism: Canis familiaris
Individual: LJ4
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: K
5'flank: GGGGCTCTTGTGAAGGGGCACTGTACCATG
3'flank: GATGAACTTCTTTGGGGTTCTTTGGGGTGT
3.Reference Map information
Chrom Position Reference LJ4
Chr1 266523 G K
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000001 55658 - G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000000001 1802 CCC => CAC ENSCAFP00000000001 601 P => H
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0060000000060 TM1 T GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0016000000069 DQ8 T GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0042000000104 KM7 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0027000000090 GS3 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0045000000066 LJ10 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0010000000069 DQ2 T GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0017000000059 DQ9 T GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0061000000070 TM2 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0078000000077 YJ9 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0043000000178 KM8 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0036000000072 KM1 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0040000000092 KM5 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0071000000065 YJ2 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0067000000063 TM8 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0063000000075 TM4 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0012000000067 DQ4 T GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0035000000080 KM10 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0009000000066 DQ1 T GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0041000000088 KM6 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0032000000086 GS8 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0023000000068 FAMICHN00003 T GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0037000000073 KM2 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0068000000056 TM9 T GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0018000000163 FAMBBEM00001 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0059000000064 TM10 T GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0004000000059 Basenji T GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0046000000067 LJ1 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0075000000065 YJ6 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0019000000081 FAMBGSD00001 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0052000000067 LJ7 T GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0064000000071 TM5 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0053000000075 LJ8 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0038000000072 KM3 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0013000000060 DQ5 T GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0062000000056 TM3 T GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0044000000074 KM9 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0025000000088 GS1 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0039000000081 KM4 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
6.Fasta Information
AGCAGTCAAG GTTATGTCTG GGGGCTCTTG TGAAGGGGCA CTGTACCATG
K
GATGAACTTC TTTGGGGTTC TTTGGGGTGT AGACAGGATT CTTTAGAAGG