e.g. 1:1246..9423
SNP Detail For snp_cf0010000000001    [See in GBrowse]
1.General Information
SNP ID: snp_cf0010000000001
Organism: Canis familiaris
Individual: DQ2
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: GGGAAATGTTGTGAGAAAAGCATGTGGAAG
3'flank: GTTGTGCCTGAACCAACGTGTATCTGAGTT
3.Reference Map information
Chrom Position Reference DQ2
Chr1 2713 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0014000000001 DQ6 G GGGAAATGTTGTGAGAAAAGCATGTGGAAG GTTGTGCCTGAACCAACGTGTATCTGAGTT 2014-07-19 2014-07-19
snp_cf0017000000001 DQ9 G GGGAAATGTTGTGAGAAAAGCATGTGGAAG GTTGTGCCTGAACCAACGTGTATCTGAGTT 2014-07-19 2014-07-19
snp_cf0060000000001 TM1 G GGGAAATGTTGTGAGAAAAGCATGTGGAAG GTTGTGCCTGAACCAACGTGTATCTGAGTT 2014-07-19 2014-07-19
6.Fasta Information
ACGTCCTCAT GTTAGTGGCA GGGAAATGTT GTGAGAAAAG CATGTGGAAG
G
GTTGTGCCTG AACCAACGTG TATCTGAGTT GAATACAGCG ATTTCCAAAG