e.g. 1:1246..9423
SNP Detail For snp_cf0015001305543    [See in GBrowse]
1.General Information
SNP ID: snp_cf0015001305543
Organism: Canis familiaris
Individual: DQ7
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: W
5'flank: CGGCTTGAGCCTCACCTCGTGTGACTTACC
3'flank: ACGAGGAGGAGCGTCAGGATCCACAAGGTG
3.Reference Map information
Chrom Position Reference DQ7
Chr18 70477 T W
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000014138 3364 - T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000022440 42 GTA => GTT ENSCAFP00000020836 14 V => V
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0014001292869 DQ6 W CGGCTTGAGCCTCACCTCGTGTGACTTACC ACGAGGAGGAGCGTCAGGATCCACAAGGTG 2014-07-19 2014-07-19
snp_cf0061001325525 TM2 W CGGCTTGAGCCTCACCTCGTGTGACTTACC ACGAGGAGGAGCGTCAGGATCCACAAGGTG 2014-07-19 2014-07-19
snp_cf0010001288755 DQ2 W CGGCTTGAGCCTCACCTCGTGTGACTTACC ACGAGGAGGAGCGTCAGGATCCACAAGGTG 2014-07-19 2014-07-19
snp_cf0073001292839 YJ4 W CGGCTTGAGCCTCACCTCGTGTGACTTACC ACGAGGAGGAGCGTCAGGATCCACAAGGTG 2014-07-19 2014-07-19
snp_cf0012001303231 DQ4 W CGGCTTGAGCCTCACCTCGTGTGACTTACC ACGAGGAGGAGCGTCAGGATCCACAAGGTG 2014-07-19 2014-07-19
snp_cf0076001348945 YJ7 W CGGCTTGAGCCTCACCTCGTGTGACTTACC ACGAGGAGGAGCGTCAGGATCCACAAGGTG 2014-07-19 2014-07-19
snp_cf0020001295564 FAMBTIM00001 A CGGCTTGAGCCTCACCTCGTGTGACTTACC ACGAGGAGGAGCGTCAGGATCCACAAGGTG 2014-07-19 2014-07-19
snp_cf0013001252398 DQ5 W CGGCTTGAGCCTCACCTCGTGTGACTTACC ACGAGGAGGAGCGTCAGGATCCACAAGGTG 2014-07-19 2014-07-19
snp_cf0062001317932 TM3 W CGGCTTGAGCCTCACCTCGTGTGACTTACC ACGAGGAGGAGCGTCAGGATCCACAAGGTG 2014-07-19 2014-07-19
snp_cf0067001279437 TM8 W CGGCTTGAGCCTCACCTCGTGTGACTTACC ACGAGGAGGAGCGTCAGGATCCACAAGGTG 2014-07-19 2014-07-19
snp_cf0009001308209 DQ1 W CGGCTTGAGCCTCACCTCGTGTGACTTACC ACGAGGAGGAGCGTCAGGATCCACAAGGTG 2014-07-19 2014-07-19
6.Fasta Information
ACTCAGAAAC GTCCGGGGCC CGGCTTGAGC CTCACCTCGT GTGACTTACC
W
ACGAGGAGGA GCGTCAGGAT CCACAAGGTG CTTAGGACCA TCTTCGTGGA