e.g. 1:1246..9423
SNP Detail For snp_cf0028001144414    [See in GBrowse]
1.General Information
SNP ID: snp_cf0028001144414
Organism: Canis familiaris
Individual: GS4
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: CTCTTCATTTTTAAGTTTCTTTCTTTTTGA
3'flank: TTTCATATTTCTACAATTACATGTCTTAAA
3.Reference Map information
Chrom Position Reference GS4
Chr2 5142 T Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0046001436011 LJ1 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0020001532318 FAMBTIM00001 C CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0066001574535 TM7 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0021001467168 FAMICHN00001 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0063001524597 TM4 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0064001560183 TM5 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0031001203852 GS7 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0019001182676 FAMBGSD00001 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0050001437656 LJ5 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0068001497139 TM9 C CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0077001565584 YJ8 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0059001534399 TM10 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0058001933827 LUPWRUS00003 C CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0007001327345 Dingo C CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0035001495733 KM10 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0048001468688 LJ3 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0030001198543 GS6 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0004001296424 Basenji C CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0026001180144 GS2 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0015001542981 DQ7 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0027001203477 GS3 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0017001555584 DQ9 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0067001517002 TM8 C CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0056001954498 LUPWRUS00001 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0049001553043 LJ4 C CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0052001508931 LJ7 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0009001541536 DQ1 C CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0045001395794 LJ10 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0047001498265 LJ2 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0042001608793 KM7 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0062001556383 TM3 C CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0078001576968 YJ9 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0060001525450 TM1 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0061001568199 TM2 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0008001535965 DQ10 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0040001369235 KM5 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0044001366436 KM9 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0006001793940 CRW Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0065001524208 TM6 C CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0073001532892 YJ4 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0075001581974 YJ6 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0029001125937 GS5 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0012001540052 DQ4 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0016001543370 DQ8 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0041001554400 KM6 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
snp_cf0023001441163 FAMICHN00003 Y CTCTTCATTTTTAAGTTTCTTTCTTTTTGA TTTCATATTTCTACAATTACATGTCTTAAA 2014-07-19 2014-07-19
6.Fasta Information
TAACTACAAT ATTTTACCTC CTCTTCATTT TTAAGTTTCT TTCTTTTTGA
Y
TTTCATATTT CTACAATTAC ATGTCTTAAA TATATTTTCC ACTTCTAGAT