e.g. 1:1246..9423
SNP Detail For snp_cf0049004087241    [See in GBrowse]
1.General Information
SNP ID: snp_cf0049004087241
Organism: Canis familiaris
Individual: LJ4
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: ACAGAAGTGTTGGGAGAGGTAATTGGAATC
3'flank: CCTGGCACACAAGACTAGCGCCTCCAAGCT
3.Reference Map information
Chrom Position Reference LJ4
Chr6 10055 T Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0035003933630 KM10 C ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0041004032391 KM6 Y ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0057004803338 LUPWRUS00002 C ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0053003966632 LJ8 C ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0009004049094 DQ1 Y ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0063003978392 TM4 C ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0026003185964 GS2 Y ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0030003155645 GS6 Y ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0039003414071 KM4 Y ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0075004149845 YJ6 C ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0070004292778 YJ1 Y ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0028003053685 GS4 C ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0052003988502 LJ7 C ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0065004038628 TM6 Y ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0047003950327 LJ2 Y ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0033003173140 GS9 C ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0061004111690 TM2 Y ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0006004653540 CRW Y ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0010004074972 DQ2 C ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0024003182195 GS10 Y ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0043003414755 KM8 Y ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0013003986889 DQ5 Y ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0044003571803 KM9 Y ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0031003200511 GS7 Y ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0071004150234 YJ2 Y ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0015004051994 DQ7 Y ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0067003995742 TM8 C ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0012004044062 DQ4 Y ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0032003113856 GS8 C ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0072004163252 YJ3 Y ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0042004207543 KM7 Y ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0007003435855 Dingo Y ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0045003705050 LJ10 C ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0018003363663 FAMBBEM00001 C ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0011004109042 DQ3 Y ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0066004155339 TM7 Y ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0017004107249 DQ9 Y ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
snp_cf0029002989900 GS5 Y ACAGAAGTGTTGGGAGAGGTAATTGGAATC CCTGGCACACAAGACTAGCGCCTCCAAGCT 2014-07-19 2014-07-19
6.Fasta Information
AGGCCTAAGC GCGCTGCTTG ACAGAAGTGT TGGGAGAGGT AATTGGAATC
Y
CCTGGCACAC AAGACTAGCG CCTCCAAGCT CAATAGAGCG ATTTCCTAGT